eprimer3 is an interface to the primer3 program from the Whitehead Institute. The Whitehead program must be set up and on the path in order for eprimer3 to find and run it. eprimer3 picks primers for PCR reactions, considering as criteria:

• Oligonucleotide melting temperature, size, GC content, and primer-dimer possibilities.

• PCR product size.

• Positional constraints within the source sequence.

• Other miscellaneous constraints.

Here is a sample session with eprimer3:

% eprimer3 em:hsfau1 hsfau.eprimer3 -explain

Mandatory qualifiers:

[-sequence] (seqall)

The sequence from which to choose primers. The sequence must be presented 5' to 3'.

[-outfile] (outfile)

Output filename.

Optional qualifiers (bold if not always prompted):

-task (menu)

Tell eprimer3 what task to perform. Legal values are:

0

Pick PCR primer.

1

Pick PCR primers and hybridization probe.

2

Pick forward primer only.

3

Pick reverse primer only.

4

Pick hybridization probe only.

The tasks should be self explanatory. Briefly, an internal oligo is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification.

-numreturn (integer)

The maximum number of primer pairs to return. Primer pairs returned are sorted by their quality, in other words, by the value of the objective function (where a lower number indicates a better primer pair). Note that setting this parameter to a large value will increase running time.

-includedregion (range)

A subregion of the given sequence from which to pick primers. For example, the first dozen or so bases of a sequence are often vector and should be excluded from consideration. The value for this parameter has the form start,end where start is the index of the first base to consider and end is the last in the primer-picking region.

-target (range)

If one or more Targets are specified, a legal primer pair must flank at least one of them. A Target might be a simple sequence repeat site (for example, a CA repeat) or a single-base-pair polymorphism. The value should be a space-separated list of start,end pairs where start is the index of the first base of a Target, and end is the last. E.g., 50,51 requires primers to surround the 2 bases at positions 50 and 51.

-excludedregion (range)

Primer oligos may not overlap any region specified in this tag. The associated value must be a space-separated list of start,end pairs where start is the index of the first base of the excluded region, and end is the last. This tag is useful for tasks such as excluding regions of low sequence quality or excluding regions containing repetitive elements such as ALUs or LINEs. E.g., 401,407 68,70 forbids selection of primers in the 7 bases starting at 401 and the 3 bases at 68.

-forwardinput (string)

The sequence of a forward primer to check, then use to design reverse primers and optional internal oligos. Must be a substring of SEQUENCE.

-reverseinput (string)

The sequence of a reverse primer to check and use to design forward primers and optional internal oligos. Must be a substring of the reverse strand of SEQUENCE.

-gcclamp (integer)

Require the specified number of consecutive Gs and Cs at the 3' end of both the forward and reverse primer. (This parameter has no effect on the internal oligo if one is requested.)

-osize (integer)

Optimum length (in bases) of a primer oligo. EPrimer3 attempts to pick primers close to this length.

-minsize (integer)

Minimum acceptable length of a primer. Must be greater than 0 and less than or equal to MAX-SIZE.

-maxsize (integer)

Maximum acceptable length (in bases) of a primer. Currently, this parameter cannot be larger than 35. This limit is governed by the maximum oligo size for which EPrimer3's melting-temperature is valid.

-otm (float)

Optimum melting temperature (Celsius) for a primer oligo. EPrimer3 will try to pick primers with melting temperatures close to this temperature. The oligo melting temperature formula in EPrimer3 is given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, Volume 18:12, pages 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proceedings of the National Academy of Sciences USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion.

-mintm (float)

Minimum acceptable melting temperature (Celsius) for a primer oligo.

-maxtm (float)

Maximum acceptable melting temperature (Celsius) for a primer oligo.

-maxdifftm (float)

Maximum acceptable (unsigned) difference between the melting temperatures of the forward and reverse primers.

-ogcpercent (float)

Primer optimum GC percent.

-mingc (float)

Minimum allowable percentage of Gs and Cs in any primer.

-maxgc (float)

Maximum allowable percentage of Gs and Cs in any primer generated by Primer.

-saltconc (float)

The millimolar concentration of salt (usually KCl) in the PCR. EPrimer3 uses this argument to calculate oligo melting temperatures.

-dnaconc (float)

The nanomolar concentration of annealing oligos in the PCR. EPrimer3 uses this argument to calculate oligo melting temperatures. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research�0.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl₂, 50mM KCl, 10mM Tris-HCl (pH 9.3) using 35 cycles with an annealing temperature of 56 degrees Celsius. This parameter corresponds to "c" in Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 12) where a suitable value (for a lower initial concentration of template) is "empirically determined". The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures.

-maxpolyx (integer)

The maximum allowable length of a mononucleotide repeat in a primer, for example AAAAAA.

-productosize (integer)

The optimum size for the PCR product. 0 indicates that there is no optimum product size.

-productsizerange (range)

The associated values specify the lengths of the product that the user wants the primers to create, and is a space separated list of elements of the form x-y where this pair is a legal range of lengths for the product. For example, if you want PCR products to be between 100 to 150 bases (inclusive), set this parameter to 100-150. If you desire PCR products in either the range from 100 to 150 bases or in the range from 200 to 250 bases, set this parameter to 100-150 200-250. EPrimer3 favors ranges to the left side of the parameter string. EPrimer3 will return legal primers pairs in the first range regardless the value of the objective function for these pairs. EPrimer3 returns primers in a subsequent range only if there is an insufficient number of primers in the first range.

-productotm (float)

The optimum melting temperature for the PCR product. 0 indicates that there is no optimum temperature.

-productmintm (float)

The minimum allowed melting temperature of the amplicon. Please see the documentation on the maximum melting temperature of the product for details.

-productmaxtm (float)

The maximum allowed melting temperature of the amplicon. Product Tm is calculated using the formula from Bolton and McCarthy, Proceedings of the National Academy of Sciences 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press). T_m = 81.5 + 16.6(log₁₀([Na⁺])) + .41*(%GC) - 600/length where [Na⁺} is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence. A similar formula is used by the prime primer selection program in GCG (http://www.gcg.com), which instead uses 675.0/length in the last term (after F. Baldino, Jr, M.-F. Chesselet, and M.E. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766 without the mismatch and formamide terms). The formulas here and in Baldino et al. assume Na⁺ rather than K⁺. According to J.G. Wetmur, Critical Reviews in Biochemistry and and Molecular Biology 26:227 (1991) 50 mM K⁺ should be equivalent in these formulae to .2 M Na⁺. EPrimer3 uses the same salt concentration value for calculating both the primer melting temperature and the oligo melting temperature. If you plan to later use the PCR product for hybridization, this behavior will not give you the Tm under hybridization conditions.

-oligoexcludedregion (range)

Middle oligos may not overlap any region specified by this tag. The associated value must be a space-separated list of start,end pairs, where start is the index of the first base of an excluded region, and end is the last. Often one would make Target regions excluded regions for internal oligos.

-oligoinput (string)

The sequence of an internal oligo to check, then use to design forward and reverse primers. Must be a substring of SEQUENCE.

-oligoosize (integer)

Optimum length (in bases) of an internal oligo. EPrimer3 will attempt to pick primers close to this length.

-oligominsize (integer)

Minimum acceptable length of an internal oligo. Must be greater than 0 and less than or equal to INTERNAL-OLIGO-MAX-SIZE.

-oligomaxsize (integer)

Maximum acceptable length (in bases) of an internal oligo. Currently, this parameter cannot be larger than 35. This limit is governed by maximum oligo size for which EPrimer3's melting temperature is valid.

-oligootm (float)

Optimum melting temperature (Celsius) for an internal oligo. EPrimer3 tries to pick oligos with melting temperatures close to this temperature. The oligo melting temperature formula in EPrimer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Procedures of the National Academy of Sciences USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion.

-oligomintm (float)

Minimum acceptable melting temperature (Celsius) for an internal oligo.

-oligomaxtm (float)

Maximum acceptable melting temperature (Celsius) for an internal oligo.

-oligoogcpercent (float)

Internal oligo optimum GC percent.

-oligomingc (float)

Minimum allowable percentage of Gs and Cs in an internal oligo.

-oligomaxgc (float)

Maximum allowable percentage of Gs and Cs in any internal oligo generated by Primer.

-oligosaltconc (float)

The millimolar concentration of salt (usually KCl) in the hybridization. EPrimer3 uses this argument to calculate internal oligo melting temperatures.

-oligodnaconc (float)

The nanomolar concentration of annealing internal oligo in the hybridization.

-oligoselfany (float)

The maximum allowable local alignment score when testing an internal oligo for (local) self-complementarity. Local self-complementarity is taken to predict the tendency of oligos to anneal to themselves. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment:

5' ATCGNA 3'
   || | |
3' TA-CGT 5'

is allowed (and yields a score of 1.75), but the alignment:

5' ATCCGNA 3'
   ||  | |
3' TA--CGT 5'

is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.

-oligoselfend (float)

The maximum allowable 3'-anchored global alignment score when testing a single oligo for self-complementarity. The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate oligos, Primer assumes that the sequence from which to choose oligos is presented 5' to 3'. INTERNAL-OLIGO-SELF-END is meaningless when applied to internal oligos used for hybridization-based detection, since primer-dimer will not occur. We recommend that INTERNAL-OLIGO-SELF-END be set at least as high as INTERNAL-OLIGO-SELF-ANY.

-oligomaxpolyx (integer)

The maximum allowable length of an internal oligo mononucleotide repeat. For example, AAAAAA.

Advanced qualifiers:

-explainflag (boolean)

If this flag is nonzero, produce LEFT-EXPLAIN, RIGHT-EXPLAIN, and INTERNAL-OLIGO-EXPLAIN output tags, which provide information on the number of oligos and primer pairs examined by EPrimer3. These tags also provide statistics on the number discarded and the reasons for these discards.

-fileflag (boolean)

If the associated value is nonzero, EPrimer3 creates two output files for each input SEQUENCE. File sequence-id.for lists all acceptable forward primers for sequence-id, and sequence-id.rev lists all acceptable reverse primers for sequence-id, where sequence-id is the value of the SEQUENCE-ID tag (which must be supplied). In addition, if the input tag TASK is 1 or 4, EPrimer3 produces a file sequence-id.int, which lists all acceptable internal oligos.

-firstbaseindex (integer)

This parameter is the index of the first base in the input sequence. For input and output using 1-based indexing (the method GenBank uses), set this parameter to 1. For input and output using 0-based indexing, set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.)

-pickanyway (boolean)

If true, pick a primer pair�even if LEFT-INPUT, RIGHT-INPUT, or INTERNAL-OLIGO-INPUT violate specific constraints.

-mispriminglibrary (infile)

The name of a file containing a nucleotide sequence library of sequences to avoid amplifying. For example, repetitive sequences or the sequences of genes in a gene family that should not be amplified are often put into this file. The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified, EPrimer3 locally aligns each candidate primer against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds MAX-MISPRIMING. (The maximum value of the weight is arbitrarily set to 100.0.) Each sequence entry in the FASTA format file must begin with an id line that starts with ">". The contents of the id line is slightly restricted in that EPrimer3 parses everything after any optional asterisk (`*') as a floating point number to use as the weight mentioned previously. If the id line contains no asterisk, the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g., SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with ">" or the end of the file. Whitespace and newlines are ignored. Characters "A", "T", "G", "C'", "a", "t", "g", "c" are retained. Any other character is converted to "N" (meaning that any IUB/IUPAC codes for ambiguous bases are converted to "N"). There are no restrictions on line length. An empty value for this parameter indicates that no repeat library should be used.

-maxmispriming (float)

The maximum allowed weighted similarity with any sequence in MISPRIMING-LIBRARY.

-pairmaxmispriming (float)

The maximum allowed sum of weighted similarities of a primer pair (one similarity for each primer) with any single sequence in MISPRIMING-LIBRARY.

-numnsaccepted (integer)

Maximum number of unknown bases N allowable in any primer.

-selfany (float)

The maximum allowable local alignment score when testing a single primer for (local) self-complementarity, and the maximumallowable local alignment score when testing for complementarity between forward and reverse primers. Local self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment:

5' ATCGNA 3'
...|| | |
3' TA-CGT 5'

is allowed (and yields a score of 1.75), but the alignment:

5' ATCCGNA 3'
...||  | |
3' TA--CGT 5'

is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.

-selfend (float)

The maximum allowable 3'-anchored global alignment score when testing a single primer for self-complementarity, and the maximum allowable 3'-anchored global alignment score when testing for complementarity between forward and reverse primers. The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example:

5' ATGCCCTAGCTTCCGGATG 3'
.............||| |||||..........
3'           AAGTCCTACATTTAGCCTAGT 5'

or:

5' AGGCTATGGGCCTCGCGA 3'
...............||||||............
3'             AGCGCTCCGGGTATCGGA 5'

The scoring system is as for the Maximum Complementarity argument. In the previous examples, the scores are 7.00 and 6.00, respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5' to 3'. It is nonsensical to provide a larger value for this parameter than that given for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment.

-maxendstability (float)

The maximum stability for the five 3' bases of a forward or reverse primer. Bigger numbers mean more stable 3' ends. The value is the maximum delta G for duplex disruption for the five 3' bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloeker and Marky, Proceedings of the National Academy of Sciences, vol 83, pp 3746-3750. EPrimer3 uses a completely permissive default value for backward compatibility (which we may change in the next release). Rychlik recommends a maximum value of 9 (Wojciech Rychlik, "Selection of Primers for Polymerase Chain Reaction" in BA White, Ed., Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications, 1993, pp 31-40, Humana Press, Totowa NJ).

-oligomishyblibrary (infile)

Similar to MISPRIMING-LIBRARY, except that the event we seek to avoid is hybridization of the internal oligo to sequences in this library rather than priming from them. The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, Proceedings of the National Academy fo Sciences 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified, EPrimer3 locally aligns each candidate oligo against each library sequence and rejects those primers for which the local alignment score times a specified weight exceeds INTERNAL-OLIGO-MAX-MISHYB. (The maximum value of the weight is arbitrarily set to 12.0.) Each sequence entry in the FASTA-format file must begin with an id line that starts with ">". The contents of the id line is slightly restricted in that EPrimer3 parses everything after any optional asterisk (`*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk, the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g., SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with ">" or the end of the file. Whitespace and newlines are ignored. Characters "A", "T", "G", "C'", "a", "t", "g", and "c" are retained and any other character is converted to "N" (meaning that any IUB / IUPAC codes for ambiguous bases are converted to "N"). There are no restrictions on line length. An empty value for this parameter indicates that no library should be used.

-oligomaxmishyb (float)

Similar to MAX-MISPRIMING, except this parameter applies to the similarity of candidate internal oligos to the library specified in INTERNAL-OLIGO-MISHYB-LIBRARY.