primersearch reads in primer pairs from an input file and searches them against sequence(s) specified by the user. Each of the primers in a pair is searched against the sequence, and potential amplimers are reported.

Here is a sample session with primersearch:

% primersearch embl:Z52466
Searches DNA sequences for matches with primer pairs
Primer file: primers
Output file [hsa203yc1.primersearch]: stdout
Allowed percent mismatch [0]: 
   
Primer name D1S243
   
Primer name D1S468
   
Primer name D1S2845
   
Primer name D1S1608
   
Primer name D1S2893
   
Primer name D1S2660
Amplimer 1
        Sequence: HSA203YC1 Z52466 
        H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.
        CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches
        AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches
        Amplimer length: 261 bp

Here we run the same example, but allow a 20% mismatch between the primers and the sequence:

unix % primersearch embl:Z52466
Searches DNA sequences for matches with primer pairs
Primer file: primers
Output file [hsa203yc1.primersearch]: stdout
Allowed percent mismatch [0]: 20
   
Primer name D1S243
   
Primer name D1S468
   
Primer name D1S2845
   
Primer name D1S1608
   
Primer name D1S2893
   
Primer name D1S2660
Amplimer 1
        Sequence: HSA203YC1 Z52466 
        H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.
        CACACATGCACATGCAC hits forward strand at 49 with 2 mismatches
        AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches
        Amplimer length: 239 bp
Amplimer 2
        Sequence: HSA203YC1 Z52466 
        H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.
        CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches
        AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches
        Amplimer length: 261 bp

Here is an example of running with a file containing a list of sequences.

% primersearch @seqs.list
Searches DNA sequences for matches with primer pairs
Primer file: primers
Output file [hs214yg7.primersearch]: stdout
Allowed percent mismatch [0]: 
   
Primer name D1S243
Amplimer 1
        Sequence: HS214YG7 Z16979 
        H. sapiens (D1S243) DNA segment containing (CA) repeat; clone AFM214yg7; single read.
        CACACAGGCTCACATGCC hits forward strand at 122 with 0 mismatches
        GCTCCAGCGTCATGGACT hits reverse strand at [36] with 0 mismatches
        Amplimer length: 162 bp
   
Primer name D1S468
Amplimer 1
        Sequence: HS280WE5 Z23994 
        H. sapiens (D1S468) DNA segment containing (CA) repeat; clone AFM280we5; single read.
        AATTAACCGTTTTGGTCCT hits forward strand at 47 with 0 mismatches
        GCGACACACACTTCCC hits reverse strand at [96] with 0 mismatches
        Amplimer length: 185 bp
   
Primer name D1S2845
Amplimer 1
        Sequence: HS344WE9 Z51474 
        H.sapiens (D1S2845) DNA segment containing (CA) repeat; clone AFM344we9; single read.
        CCAAAGGGTGCTTCTC hits forward strand at 29 with 0 mismatches
        GTGGCATTCCAACCTC hits reverse strand at [157] with 0 mismatches
        Amplimer length: 201 bp
   
Primer name D1S1608
Amplimer 1
        Sequence: HS829186 G07829 
        human STS CHLC.GATA49A06.P15262 clone GATA49A06, sequence tagged site.
        GATGGCTTTTGGGGACTATT hits forward strand at 13 with 0 mismatches
        CACTGAGCCAAGTGACACAG hits reverse strand at [92] with 0 mismatches
        Amplimer length: 270 bp
   
Primer name D1S2893
Amplimer 1
        Sequence: HS123XC3 Z50993 
        H.sapiens (D1S2893) DNA segment containing (CA) repeat; clone AFM123xc3; single read.
        AAAACATCAACTCTCCCCTG hits forward strand at 5 with 0 mismatches
        CTCAAACCCCAATAAGCCTT hits reverse strand at [3] with 0 mismatches
        Amplimer length: 215 bp
   
Primer name D1S2660
Amplimer 1
        Sequence: HSA203YC1 Z52466 
        H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.
        CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches
        AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches
        Amplimer length: 261 bp

Mandatory qualifiers:

[-sequences] (seqall)

Sequence database USA.

[-primers] (infile)

Primer file.

[-mismatchpercent] (integer)

Allowed percent mismatch.

[-out] (outfile)

Output filename .